Human identical sequence

The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome.^[1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.^[2]^[3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.^[1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).^[1]

SARS-CoV-2

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-SARS2-1	26	UGUCUAUGCUAAUGGAGGUAAAGGCU	7570–7595 in ORF1a	Chr3: 124017420-124017395	KALRN
HIS-SARS2-2	24	UAUAACACAUATAAAAAUACGUGU	12494–12517 in ORF1a	Chr3: 176597319-176597342
HIS-SARS2-3	24	UUAUAUGCCUUAUUUCUUUACUUU	6766–6789 in ORF1a	Chr5: 28949255-28949232
HIS-SARS2-4	27	AGGAGAAUGACAAAAAAAAAAAAAAAA	29860–29886 in 3' UTR	Chr18: 73670168-73670142	FBXO15, TIMM21 [uk], CYB5A	same as HIS-SARS1-2
HIS-SARS2-5	24	UUGUUGCUGCUAUUUUCUAUUUAA	8610–8633 in ORF1a	ChrX: 99693480-99693457

SARS-CoV-1

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-SARS-1	25	UAACAUGCUUAGGAUAAUGGCCUCU	15251–15275 in ORF1b	Chr4: 172887105–172887129 Chr8: 122356667-122356690	HAS2, ZHX2
HIS-SARS-2	27	AGGAGAAUGACAAAAAAAAAAAAAAAA	29717–29743 in 3' UTR	Chr18: 73670168-73670142		same as HIS-SARS2-4

MERS-CoV

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-MERS-1	24	UUCCAUUUGCACAGAGUAUCUUUU	24364–24387 in S	ChrX: 25635779-25635802

HCoV-HKU1

name	length	sequence	location in virus genome	location in human genome
HIS-HKU1-1	24	UUAGAAUUGUUCAAAUGUUAUCUG	18656-18679	chr1:106816197-106816220
HIS-HKU1-2	24	UUUUCUAAGAAAGAUUGGUAUGAU	14044-14067	chr1:226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390
HIS-HKU1-3	24	AUUUGACUUUAAAUCUUCAUACUA	26693-26716	chr4:11718458-11718481
HIS-HKU1-4	24	GAUUGGUUGUAUUUUCAUUUUUAU	23527-23550	chr4:33759646-33759669
HIS-HKU1-5	24	UAGAUACUGUUAUUUUUAAAAAUA	19844-19867	chrX:81711130-81711153

HCoV-NL63

name	length	sequence	location in virus genome	location in human genome
HIS-NL63-1	24	UUAUGAUUUUGGUGAUUUUGUUGU	13044-13067	chr1:215311768-215311791
HIS-NL63-2	24	GGUGUUUUUGUUGAUGAUGUUGUU	14920-14943	chr4:28254452-28254475
HIS-NL63-3	24	AUAGGCUUAAAUGCUUCUGUUACU	20754-20777	chr6:30469931-30469954
HIS-NL63-4	24	AAGUAAUUGUAUUAAGAUGUUAUC	12124-12147	chr7:19853545-19853568
HIS-NL63-5	24	AACUUUUAUGAUUUUGGUGAUUUU	13039-13062	chr9:1525276-1525299

HCoV-OC43

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-OC43-1	24	UACAGCUCUUUGUAAAUCUGGUAG	22827-22850	chr8:122471006-122471029	HAS2, ZHX2
HIS-OC43-2	24	UUGUAUGAGUGAUUUUAUGAGUGA	24509-24532	chr13:30510223-30510246

HCoV-229E

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-229E-1	24	AAUAUUUUAACAGUACCACGUUAU	19817-19840	chr8:42865576-42865599
HIS-229E-2	24	ACUUUGUAUUGUGUCCUCCUGGAA	13139-13162	chr11:112451251-112451274

References

^ ^a ^b ^c Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMC 8811534. PMID 35124429.
^ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal Transduction and Targeted Therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMC 8931182. PMID 35304437.
^ Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC 5711461. PMID 26853707.

This genetics article is a stub. You can help Wikipedia by expanding it.

[:0-1] Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMC 8811534. PMID 35124429.

[:1-2] Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal Transduction and Targeted Therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMC 8931182. PMID 35304437.

[X-3] Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC 5711461. PMID 26853707.

[1]

[2]

[3]

v t e Coronavirus genomes
Viral structural protein	spike protein (S) envelope protein (E) membrane protein (M) nucleocapsid protein (N)
Viral nonstructural protein (expressed from ORF1ab)	nonstructural protein 1 nonstructural protein 2 papain-like protease (nsp3) nonstructural protein 4 3C-like protease (nsp5) nonstructural protein 6 nonstructural protein 7 nonstructural protein 8 nonstructural protein 9 nonstructural protein 10 nonstructural protein 11 nonstructural protein 12 nonstructural protein 13 nonstructural protein 14 nonstructural protein 15 nonstructural protein 16
Viral accessory protein	ORF3a ORF3b ORF3c ORF3d ORF6 ORF7a ORF7b ORF8 ORF9b ORF9c ORF10
RNA	Coronavirus 5′ UTR Coronavirus 3′ UTR Coronavirus 3′ UTR pseudoknot Coronavirus 3′ stem-loop II-like motif (s2m) Coronavirus packaging signal Coronavirus frameshifting stimulation element Human identical sequence