Human identical sequence

From Wikipedia the free encyclopedia

The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome.[1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.[2][3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.[1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).[1]

SARS-CoV-2

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-SARS2-1 26 UGUCUAUGCUAAUGGAGGUAAAGGCU 7570–7595 in ORF1a Chr3: 124017420-124017395 KALRN
HIS-SARS2-2 24 UAUAACACAUATAAAAAUACGUGU 12494–12517 in ORF1a Chr3: 176597319-176597342
HIS-SARS2-3 24 UUAUAUGCCUUAUUUCUUUACUUU 6766–6789 in ORF1a Chr5: 28949255-28949232
HIS-SARS2-4 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29860–29886 in 3' UTR Chr18: 73670168-73670142 FBXO15, TIMM21 [uk], CYB5A same as HIS-SARS1-2
HIS-SARS2-5 24 UUGUUGCUGCUAUUUUCUAUUUAA 8610–8633 in ORF1a ChrX: 99693480-99693457

SARS-CoV-1

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-SARS-1 25 UAACAUGCUUAGGAUAAUGGCCUCU 15251–15275 in ORF1b Chr4: 172887105–172887129
Chr8: 122356667-122356690
HAS2, ZHX2
HIS-SARS-2 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29717–29743 in 3' UTR Chr18: 73670168-73670142 same as HIS-SARS2-4

MERS-CoV

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-MERS-1 24 UUCCAUUUGCACAGAGUAUCUUUU 24364–24387 in S ChrX: 25635779-25635802

HCoV-HKU1

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-HKU1-1 24 UUAGAAUUGUUCAAAUGUUAUCUG 18656-18679 chr1:106816197-106816220
HIS-HKU1-2 24 UUUUCUAAGAAAGAUUGGUAUGAU 14044-14067 chr1:226438633-226438656
chr4:151100495-151100518
chr5:79284823-79284846
chr5:111192947-111192970
chr7:94695722-94695745
chr7:98386489-98386512
chr15:59768424-59768447
chr22:30137367-30137390
HIS-HKU1-3 24 AUUUGACUUUAAAUCUUCAUACUA 26693-26716 chr4:11718458-11718481
HIS-HKU1-4 24 GAUUGGUUGUAUUUUCAUUUUUAU 23527-23550 chr4:33759646-33759669
HIS-HKU1-5 24 UAGAUACUGUUAUUUUUAAAAAUA 19844-19867 chrX:81711130-81711153

HCoV-NL63

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-NL63-1 24 UUAUGAUUUUGGUGAUUUUGUUGU 13044-13067 chr1:215311768-215311791
HIS-NL63-2 24 GGUGUUUUUGUUGAUGAUGUUGUU 14920-14943 chr4:28254452-28254475
HIS-NL63-3 24 AUAGGCUUAAAUGCUUCUGUUACU 20754-20777 chr6:30469931-30469954
HIS-NL63-4 24 AAGUAAUUGUAUUAAGAUGUUAUC 12124-12147 chr7:19853545-19853568
HIS-NL63-5 24 AACUUUUAUGAUUUUGGUGAUUUU 13039-13062 chr9:1525276-1525299

HCoV-OC43

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-OC43-1 24 UACAGCUCUUUGUAAAUCUGGUAG 22827-22850 chr8:122471006-122471029 HAS2, ZHX2
HIS-OC43-2 24 UUGUAUGAGUGAUUUUAUGAGUGA 24509-24532 chr13:30510223-30510246

HCoV-229E

[edit]
name length sequence location in virus genome location in human genome neighboring genes note
HIS-229E-1 24 AAUAUUUUAACAGUACCACGUUAU 19817-19840 chr8:42865576-42865599
HIS-229E-2 24 ACUUUGUAUUGUGUCCUCCUGGAA 13139-13162 chr11:112451251-112451274

References

[edit]
  1. ^ a b c Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMC 8811534. PMID 35124429.
  2. ^ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal Transduction and Targeted Therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMC 8931182. PMID 35304437.
  3. ^ Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC 5711461. PMID 26853707.